Scientific Interests

As a molecular geneticist I stand on a hypothesis that most of biological phenomena can be explained by deciphering DNA sequence. Decipherment of DNA sequence must be carried out by a combination of computational analyses of DNA databases by well-written programs and actual biological functional assay, such as, viral vector mediated gene-transfer studies or transgenic studies. My 15 years of career on biomedical research (a lot of sleepless night) have been devoted to the handling of biological materials (proteins, DNAs, cultured cells and mice). I agree the conventional biological approach is a primary method to elucidate biological function. But now I predict that computational analyses of DNA sequence would yield also as productive as conventional biological experiments. Here is my conceptual and ambitious theory. Biological language (genetic code) is very close to the computer's binary language so that compilation of known words (what does what) would lead to absolute decipherment of entire language in future. You may have a chance to enjoy the excitement of Michael Ventris who deciphered Minoan linear-B script and showed it to be a very archaic form of Greek, dating from about 1500 to 1200 BC.

• Here are examples:
• Let's translate the following English language to other languages.

  "I love you."

• Hexadecimal Language.

  "49A06C6F7665A0796F752E"

• Binary language (Computer's Language)

  "0100100110100000011011000110111101110110

  011001011010000001111001011011110111010100101110"

• Quaternary language (Biological Language, genetic code): A demonstrative translation. It could be "I love you" or "I hate you" or else.

  "AGCTTTGCTGGACGGTTGGTTTTTAACCGG

  TGGTTCCAAGGTTGGCTGAC"

---

My chronicle (.PDF)

---

Let's study the basics of electromagnetic waves together.
My progress notes and study guides since Octorber 2005.
Photon's Energy (.PDF)
Photons Generator (.PDF)

---

Let's study the interaction of electromagnetic waves (photons)
and neuronal electrical activities together.
Direct Reading of Thinking (.PDF)

---